caatgaggccggggcatcatggccccggaatacggctcttttccg
The query sequence (length=45) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7mib:J | 45 | 45 | 1.0000 | 1.0000 | 1.0000 | 2.09e-19 | |
| 2 | 7mi9:G | 80 | 45 | 1.0000 | 0.5625 | 1.0000 | 2.09e-19 | |
| 3 | 7mib:H | 64 | 33 | 0.7333 | 0.5156 | 1.0000 | 9.78e-13 | |
| 4 | 7mi9:H | 72 | 33 | 0.7333 | 0.4583 | 1.0000 | 9.78e-13 |
umich.edu