BioLiP

>dna
agggcgcctataaaagggggtgggggcgcgttcgtcctcagtcgcgatcgaacactcgagccgagcagacg

The query sequence (length=71) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5iyc:Y	80	71	1.0000	0.8875	1.0000	1.37e-33	5iyd:Y
2	5iyb:Y	75	71	1.0000	0.9467	1.0000	1.37e-33
3	5iy7:Y	77	71	1.0000	0.9221	1.0000	1.37e-33
4	5fur:F	80	71	1.0000	0.8875	1.0000	1.37e-33	6mzm:U
5	5fur:E	80	71	1.0000	0.8875	1.0000	1.37e-33	6mzm:V
6	7eg9:Y	71	71	1.0000	1.0000	1.0000	1.37e-33
7	7eg9:X	71	71	1.0000	1.0000	1.0000	1.37e-33
8	7eg7:Y	71	70	0.9859	0.9859	1.0000	4.93e-33
9	7eg7:X	71	70	0.9859	0.9859	1.0000	4.93e-33
10	5iy8:Y	83	71	0.9859	0.8434	0.9859	6.38e-32	5iy9:Y
11	7egb:Y	69	68	0.9577	0.9855	1.0000	6.38e-32	7ena:Y, 7enc:Y
12	7egb:X	69	68	0.9577	0.9855	1.0000	6.38e-32	7ena:X, 7enc:X
13	7egj:Y	74	65	0.9155	0.8784	1.0000	2.97e-30
14	7egj:X	74	65	0.9155	0.8784	1.0000	2.97e-30
15	7egd:Y	72	64	0.9014	0.8889	1.0000	1.07e-29
16	7egd:X	72	64	0.9014	0.8889	1.0000	1.07e-29
17	5iy6:Y	65	63	0.8873	0.9692	1.0000	3.84e-29	6o9l:Y
18	5iy6:X	65	63	0.8873	0.9692	1.0000	3.84e-29	6o9l:X
19	7lbm:V	64	62	0.8732	0.9688	1.0000	1.38e-28
20	7lbm:U	64	62	0.8732	0.9688	1.0000	1.38e-28
21	5iya:Y	59	57	0.8028	0.9661	1.0000	8.32e-26
22	5iya:X	59	57	0.8028	0.9661	1.0000	8.32e-26
23	8gxq:Y	67	66	0.8732	0.9254	0.9394	1.39e-23	8gxs:Y
24	8gxq:X	67	66	0.8732	0.9254	0.9394	1.39e-23	8gxs:X
25	5iyb:X	75	73	0.9014	0.8533	0.8767	1.40e-18
26	5iy7:X	77	73	0.9014	0.8312	0.8767	1.40e-18
27	7egh:Y	45	37	0.5211	0.8222	1.0000	1.09e-14
28	7egh:X	45	37	0.5211	0.8222	1.0000	1.09e-14
29	7nvt:T	50	43	0.5634	0.8000	0.9302	5.08e-13
30	7nvt:N	50	40	0.5352	0.7600	0.9500	5.08e-13
31	7nvs:T	49	43	0.5634	0.8163	0.9302	5.08e-13
32	7nvs:N	49	40	0.5352	0.7755	0.9500	5.08e-13
33	7nvr:T	64	43	0.5634	0.6250	0.9302	5.08e-13	7nvy:T, 7nvz:T
34	7nvr:N	64	40	0.5352	0.5938	0.9500	5.08e-13	7nvy:N, 7nvz:N
35	8byq:T	198	43	0.5634	0.2020	0.9302	5.08e-13	8bz1:T
36	8byq:N	198	40	0.5352	0.1919	0.9500	5.08e-13	8bz1:N
37	8bvw:T	206	43	0.5634	0.1942	0.9302	5.08e-13
38	8bvw:N	206	40	0.5352	0.1845	0.9500	5.08e-13
39	5iyc:X	80	71	0.8028	0.7125	0.8028	3.06e-10	5iyd:X
40	5iy8:X	83	71	0.8028	0.6867	0.8028	3.06e-10	5iy9:X

[Back]