aggccgctgctgctcaagaggggttcgcgggacggcatcggccaattggcccggtgtgtcgcacgatctgg
The query sequence (length=71) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8dy7:P | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 1.37e-33 | |
| 2 | 8dy7:O | 78 | 55 | 0.7746 | 0.7051 | 1.0000 | 1.08e-24 | |
| 3 | 8dy9:P | 38 | 31 | 0.4366 | 0.8158 | 1.0000 | 2.36e-11 | |
| 4 | 8dy9:O | 38 | 31 | 0.4366 | 0.8158 | 1.0000 | 2.36e-11 |
umich.edu