acctggtgtgtgggtgttgtgtggtgttcac
The query sequence (length=31) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4gfb:D | 31 | 31 | 1.0000 | 1.0000 | 1.0000 | 7.59e-12 | 3ukg:D |
2 | 3ukg:C | 31 | 29 | 0.9355 | 0.9355 | 1.0000 | 9.81e-11 |