aagtacctcccaactacttttcctcacacttgtactcca
The query sequence (length=39) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6rql:U | 42 | 39 | 1.0000 | 0.9286 | 1.0000 | 3.98e-16 | |
2 | 6rql:T | 42 | 39 | 1.0000 | 0.9286 | 1.0000 | 3.98e-16 | |
3 | 6rqh:U | 39 | 39 | 1.0000 | 1.0000 | 1.0000 | 3.98e-16 | |
4 | 6rqh:T | 39 | 39 | 1.0000 | 1.0000 | 1.0000 | 3.98e-16 | |
5 | 6ruo:T | 50 | 35 | 0.8974 | 0.7000 | 1.0000 | 6.67e-14 | 6rwe:T |
6 | 6rrd:U | 48 | 35 | 0.8974 | 0.7292 | 1.0000 | 6.67e-14 | |
7 | 6rrd:T | 51 | 33 | 0.8462 | 0.6471 | 1.0000 | 8.62e-13 | |
8 | 5w5y:T | 54 | 32 | 0.8205 | 0.5926 | 1.0000 | 3.10e-12 | 5w64:T, 5w65:T, 5w66:T |
9 | 6rui:U | 46 | 32 | 0.8205 | 0.6957 | 1.0000 | 3.10e-12 | |
10 | 6rui:T | 48 | 32 | 0.8205 | 0.6667 | 1.0000 | 3.10e-12 | |
11 | 6rwe:U | 45 | 30 | 0.7692 | 0.6667 | 1.0000 | 4.01e-11 | |
12 | 6ruo:U | 43 | 34 | 0.8462 | 0.7674 | 0.9706 | 4.01e-11 |