Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
Download all results in tab-seperated text for 4 receptor-ligand interactions, whose format is explained at readme.txt.
  • Hover over PDB to view the title of the structure. Click PDB to view the structure at the RCSB PDB database. Resolution -1.00 means the resolution is unavailable, e.g., for NMR structures.
  • Click Site # to view the binding site structure. Hover over Site # to view the binding residues.
  • The sequence is converted from residues with experimentally determined coordinates in the structure; residues not observed in the 3D structure are excluded.
  • Hover over EC number to view the full name of enzymatic activity.
  • Hover over GO terms to view all GO terms.
  • Hover over UniProt to view the protein name.

    • Sort results by
    << < 1 > >>
    Go to page

    # PDB
    (resolution)     		Site
    #     		RNA
    sequence         		EC
    number     		GO
    terms     		UniProt PubMed Binding
    affinity
    1 8k2b:LR
    (3.4)    		 BS02 >8k2b:L2 (identical to 7a5f:B3, 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 7l08:B, 7l20:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2)
    agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>..
    		 N/A GO:0005737 ... A8K9D2 38942792
    2 8k2b:Ll
    (3.4)    		 BS02 >8k2b:L2 (identical to 7a5f:B3, 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 7l08:B, 7l20:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2)
    agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>..
    		 N/A GO:0005515 ... Q96DV4 38942792
    3 8k2b:Ln
    (3.4)    		 BS01 >8k2b:L2 (identical to 7a5f:B3, 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 7l08:B, 7l20:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2)
    agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>..
    		 N/A GO:0003723 ... Q9NQ50 38942792
    4 8k2b:Lv
    (3.4)    		 BS02 >8k2b:L2 (identical to 7a5f:B3, 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 7l08:B, 7l20:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2)
    agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>..
    		 N/A GO:0005515 ... Q96GC5 38942792
    Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218