BioLiP

Download all results in tab-seperated text for 4 receptor-ligand interactions, whose format is explained at readme.txt.

Hover over PDB to view the title of the structure. Click PDB to view the structure at the RCSB PDB database. Resolution -1.00 means the resolution is unavailable, e.g., for NMR structures.

Click Site # to view the binding site structure. Hover over Site # to view the binding residues.

The sequence is converted from residues with experimentally determined coordinates in the structure; residues not observed in the 3D structure are excluded.

Hover over EC number to view the full name of enzymatic activity.

Hover over GO terms to view all GO terms.

Hover over UniProt to view the protein name.

<< < 1 > >>

#	PDB (resolution)	Site #	DNA sequence	EC number	GO terms	UniProt	PubMed
1	6oeo:A (3.69)	BS02	>6oeo:I (identical to 6oem:I, 6oen:I, 6oep:I, 6oeq:I, 6oer:I) gatctggcctgtcttacacagtgatacagcccttaacaaaaacccg	2.3.2.27 3.1.-.-	GO:0002250 ...	P15919	32015552
2	6oeo:B (3.69)	BS01	>6oeo:I (identical to 6oem:I, 6oen:I, 6oep:I, 6oeq:I, 6oer:I) gatctggcctgtcttacacagtgatacagcccttaacaaaaacccg	?	GO:0002313 ...	P21784	32015552
3	6oeo:C (3.69)	BS02	>6oeo:I (identical to 6oem:I, 6oen:I, 6oep:I, 6oeq:I, 6oer:I) gatctggcctgtcttacacagtgatacagcccttaacaaaaacccg	2.3.2.27 3.1.-.-	GO:0002250 ...	P15919	32015552
4	6oeo:N (3.69)	BS02	>6oeo:I (identical to 6oem:I, 6oen:I, 6oep:I, 6oeq:I, 6oer:I) gatctggcctgtcttacacagtgatacagcccttaacaaaaacccg	?	GO:0003677 ...	P09429	32015552