Structure of PDB 8rct Chain z2 Binding Site BS02

Receptor Information

>8rct Chain z2 (length=76) Species: 562 (Escherichia coli)

TRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTL
FAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>8rct Chain 82 (length=120)

ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcau

<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>.

Receptor-Ligand Complex Structure

Structure summary

• PDB: 8rct Transient disome complex formation in native polysomes during ongoing protein synthesis captured by cryo-EM.
• Resolution: 5.32 Å
• Binding residue (original residue number in PDB): G73 P74
• Binding residue (residue number reindexed from 1): G64 P65

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:8rct, PDBe:8rct, PDBj:8rct
• PDBsum: 8rct
• PubMed: 38409277
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)