Structure of PDB 7zp8 Chain z Binding Site BS02

Receptor Information
>7zp8 Chain z (length=33) Species: 44689 (Dictyostelium discoideum) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
ANGEDSSFGSFTFTVELFSTPVWIWWWPRIRGP
Ligand information
>7zp8 Chain v (length=76) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ggugauuggcgcagccugguagcgcacuucguucgggacgaaggggucgg
agguucgaauccucuaucaccgacca
..........<.............>.<<<<<.......>>>>>.....<<
<<<.......>>>>>...........
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7zp8 Modulating co-translational protein folding by rational design and ribosome engineering.
Resolution2.2 Å
Binding residue
(original residue number in PDB)		G165 P166
Binding residue
(residue number reindexed from 1)		G32 P33
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0051015 actin filament binding
Biological Process
GO:0030036 actin cytoskeleton organization

View graph for
Molecular Function
View graph for
Biological Process
External links
PDB RCSB:7zp8, PDBe:7zp8, PDBj:7zp8
PDBsum7zp8
PubMed35869078
UniProtP13466|GELA_DICDI Gelation factor (Gene Name=abpC)

[Back to BioLiP]