Structure of PDB 7jt2 Chain w Binding Site BS02

Receptor Information
>7jt2 Chain w (length=75) Species: 83333 (Escherichia coli K-12) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
RNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTLF
AKADGKVKFEVKGPKNRKFISIEAE
Ligand information
>7jt2 Chain 2 (length=120) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcaa
.<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>..
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7jt2 ArfB can displace mRNA to rescue stalled ribosomes
Resolution3.5 Å
Binding residue
(original residue number in PDB)		G69 P70 N72
Binding residue
(residue number reindexed from 1)		G63 P64 N66
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7jt2, PDBe:7jt2, PDBj:7jt2
PDBsum7jt2
PubMed33144582
UniProtP0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)

[Back to BioLiP]