Structure of PDB 8ap4 Chain v Binding Site BS02

Receptor Information

>8ap4 Chain v (length=78) Species: 83333 (Escherichia coli K-12)

GSTRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDH
TLFAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>8ap4 Chain b (length=119)

ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggca

<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>

Receptor-Ligand Complex Structure

Structure summary

• PDB: 8ap4 Structure of Escherichia coli heat shock protein Hsp15 in complex with the ribosomal 50S subunit bearing peptidyl-tRNA.
• Resolution: 3.0 Å
• Binding residue (original residue number in PDB): G73 P74 N76
• Binding residue (residue number reindexed from 1): G66 P67 N69

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:8ap4, PDBe:8ap4, PDBj:8ap4
• PDBsum: 8ap4
• PubMed: 36370110
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)