Structure of PDB 7pex Chain u Binding Site BS02

Receptor Information
>7pex Chain u (length=75) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
SGPPVSELITKAVAASKERSGVSLAALKKALAAAGYDVEKNNSRIKLGLK
SLVSKGTLVQTKGTGASGSFKLNKK
Ligand information
>7pex Chain I (length=177) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gagcatccggatcccctggagaatcccggtgccgaggccgctcaattggt
cgtagacagctctagcaccgcttaaacgcacgtacgcgctgtcccccgcg
ttttaaccgccaaggggattactccctagtctccaggcacgtgtcacata
tatacatcctgttccagtgccggaccc
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7pex Histone H1 binding to nucleosome arrays depends on linker DNA length and trajectory.
Resolution5.1 Å
Binding residue
(original residue number in PDB)		K80 A100
Binding residue
(residue number reindexed from 1)		K46 A66
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003677 DNA binding
GO:0003690 double-stranded DNA binding
GO:0003723 RNA binding
GO:0005515 protein binding
GO:0030527 structural constituent of chromatin
GO:0031490 chromatin DNA binding
GO:0031492 nucleosomal DNA binding
GO:0042826 histone deacetylase binding
Biological Process
GO:0000122 negative regulation of transcription by RNA polymerase II
GO:0006325 chromatin organization
GO:0006334 nucleosome assembly
GO:0006357 regulation of transcription by RNA polymerase II
GO:0030261 chromosome condensation
GO:0045910 negative regulation of DNA recombination
Cellular Component
GO:0000786 nucleosome
GO:0000791 euchromatin
GO:0000792 heterochromatin
GO:0005634 nucleus
GO:0005694 chromosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7pex, PDBe:7pex, PDBj:7pex
PDBsum7pex
PubMed35581345
UniProtP10412|H14_HUMAN Histone H1.4 (Gene Name=H1-4)

[Back to BioLiP]