Structure of PDB 8ury Chain b Binding Site BS02

Receptor Information
>8ury Chain b (length=76) Species: 562 (Escherichia coli) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
TRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTL
FAKADGKVKFEVKGPKNRKFISIEAE
Ligand information
>8ury Chain d (length=120) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcau
<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB8ury Structural basis of RfaH-mediated transcription-translation coupling
Resolution3.1 Å
Binding residue
(original residue number in PDB)		G73 P74 N76
Binding residue
(residue number reindexed from 1)		G64 P65 N67
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:8ury, PDBe:8ury, PDBj:8ury
PDBsum8ury
PubMed39117885
UniProtP0A7M0|RL27_ECO57 Large ribosomal subunit protein bL27 (Gene Name=rpmA)

[Back to BioLiP]