Structure of PDB 8urh Chain b Binding Site BS02

Receptor Information
>8urh Chain b (length=76) Species: 562 (Escherichia coli) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
TRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTL
FAKADGKVKFEVKGPKNRKFISIEAE
Ligand information
>8urh Chain d (length=120) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcau
<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB8urh Escherichia coli transcription-translation coupled complex class A (TTC-A) containing RfaH bound to ops signal, mRNA with a 21 nt long spacer, and fMet-tRNAs in E-site and P-site of the ribosome
Resolution5.7 Å
Binding residue
(original residue number in PDB)		G73 P74 N76
Binding residue
(residue number reindexed from 1)		G64 P65 N67
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0000049 tRNA binding
GO:0003735 structural constituent of ribosome
GO:0005515 protein binding
GO:0019843 rRNA binding
GO:0043022 ribosome binding
Biological Process
GO:0000027 ribosomal large subunit assembly
GO:0001558 regulation of cell growth
GO:0002181 cytoplasmic translation
GO:0006412 translation
GO:0042256 cytosolic ribosome assembly
GO:0090070 positive regulation of ribosome biogenesis
GO:1902626 assembly of large subunit precursor of preribosome
Cellular Component
GO:0005737 cytoplasm
GO:0005840 ribosome
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:8urh, PDBe:8urh, PDBj:8urh
PDBsum8urh
PubMed39117885
UniProtP0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)

[Back to BioLiP]