Structure of PDB 7mt2 Chain Z Binding Site BS02

Receptor Information
>7mt2 Chain Z (length=59) Species: 83332 (Mycobacterium tuberculosis H37Rv) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
SQLKITQVRSTIGARWKQRESLRTLGLRRIRHSVIREDNAATRGLIAVVR
HLVEVEPAQ
Ligand information
>7mt2 Chain B (length=115) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
uuacggcggccacagcggcagggaaacgcccggucccauuccgaacccgg
aagcuaagccugccagcgccgaugauacugccccuccggguggaaaagua
ggacaccgccgaaca
<..<<<<<<.....<<<<<<<<.....<<<<<...............>>>
..>>....>>>>>>.>>.<<.......<<<<<<....>>>>>>.......
>>...>>>>>>.>..
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7mt2 Interplay between an ATP-binding cassette F protein and the ribosome from Mycobacterium tuberculosis.
Resolution2.76 Å
Binding residue
(original residue number in PDB)		R16 Q19 H52
Binding residue
(residue number reindexed from 1)		R15 Q18 H51
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome
GO:0015934 large ribosomal subunit
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7mt2, PDBe:7mt2, PDBj:7mt2
PDBsum7mt2
PubMed35064151
UniProtP9WHA3|RL30_MYCTU Large ribosomal subunit protein uL30 (Gene Name=rpmD)

[Back to BioLiP]