Structure of PDB 8g7p Chain Y Binding Site BS02

Receptor Information

>8g7p Chain Y (length=76) Species: 562 (Escherichia coli)

TRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTL
FAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>8g7p Chain B (length=120)

ugccuggcggcaguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcau

<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>.

Receptor-Ligand Complex Structure

Structure summary

• PDB: 8g7p Structures of the ribosome bound to EF-Tu-isoleucine tRNA elucidate the mechanism of AUG avoidance
• Resolution: 2.9 Å
• Binding residue (original residue number in PDB): G73 P74 N76
• Binding residue (residue number reindexed from 1): G64 P65 N67

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:8g7p, PDBe:8g7p, PDBj:8g7p
• PDBsum: 8g7p
• PubMed: 38538914
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)