Structure of PDB 6s0x Chain X Binding Site BS02

Receptor Information
>6s0x Chain X (length=58) Species: 1280 (Staphylococcus aureus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
AKLQITLTRSVIGRPETQRKTVEALGLKKTNSSVVVEDNPAIRGQINKVK
HLVTVEEK
Ligand information
>6s0x Chain B (length=115) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ucuggugacuauagcaaggaggucacaccuguucccaugccgaacacaga
aguuaagcuccuuagcgucgaugguagucgaacuuacguuccgcuagagu
agaacguugccaggc
.<<<<<<<<....<<<<<<<<.....<<<<<...............>>>.
.>>....>>>>>>.>>.<<.....<<<<.<<<<....>>>>.>>>..>..
.>>..>>>>>>>>..
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB6s0x Exit tunnel modulation as resistance mechanism of S. aureus erythromycin resistant mutant.
Resolution2.425 Å
Binding residue
(original residue number in PDB)		R15 H52
Binding residue
(residue number reindexed from 1)		R14 H51
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome
GO:0015934 large ribosomal subunit
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:6s0x, PDBe:6s0x, PDBj:6s0x
PDBsum6s0x
PubMed31391518
UniProtW8UVN7

[Back to BioLiP]