Structure of PDB 8c90 Chain W Binding Site BS02

Receptor Information

>8c90 Chain W (length=70) Species: 562 (Escherichia coli)

SEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTLFAKADG
KVKFEVKGPKNRKFISIEAE

Ligand information

>8c90 Chain B (length=119)

ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggca

<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.....<.<<<<<<<<...>>>>>>>>...
>...>>...>>>>>>>>>>

Receptor-Ligand Complex Structure

Structure summary

• PDB: 8c90 Cryo-EM captures early ribosome assembly in action.
• Resolution: 3.15 Å
• Binding residue (original residue number in PDB): P70 N72
• Binding residue (residue number reindexed from 1): P59 N61

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:8c90, PDBe:8c90, PDBj:8c90
• PDBsum: 8c90
• PubMed: 36797249
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)