Structure of PDB 7otc Chain W Binding Site BS02

Receptor Information
>7otc Chain W (length=84) Species: 469008 (Escherichia coli BL21(DE3)) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
AHKKAGGSTRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANV
GCGRDHTLFAKADGKVKFEVKGPKNRKFISIEAE
Ligand information
>7otc Chain B (length=120) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcau
<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7otc The cyclic octapeptide antibiotic argyrin B inhibits translation by trapping EF-G on the ribosome during translocation.
Resolution2.9 Å
Binding residue
(original residue number in PDB)		K72 G73 P74 N76
Binding residue
(residue number reindexed from 1)		K71 G72 P73 N75
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7otc, PDBe:7otc, PDBj:7otc
PDBsum7otc
PubMed35500116
UniProtA0A140N340

[Back to BioLiP]