Structure of PDB 6om6 Chain W Binding Site BS02

Receptor Information

>6om6 Chain W (length=84) Species: 562 (Escherichia coli)

AHKKAGGSTRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANV
GCGRDHTLFAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>6om6 Chain 3 (length=120)

ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcau

<<<<<<<<<<.....<<<<<<<<....<<<<<<...............>>
>..>>>...>>>>>>.>>.<<...<...<<<<<<<<...>>>>>>>>...
..>.>>...>>>>>>>>>>.

Receptor-Ligand Complex Structure

Structure summary

• PDB: 6om6 trans-Translation inhibitors bind to a novel site on the ribosome and clear Neisseria gonorrhoeae in vivo.
• Resolution: 3.1 Å
• Binding residue (original residue number in PDB): G73 P74 N76
• Binding residue (residue number reindexed from 1): G72 P73 N75

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:6om6, PDBe:6om6, PDBj:6om6
• PDBsum: 6om6
• PubMed: 33741965
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)