Structure of PDB 6gc8 Chain W Binding Site BS02

Receptor Information
>6gc8 Chain W (length=76) Species: 83333 (Escherichia coli K-12) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
TRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTL
FAKADGKVKFEVKGPKNRKFISIEAE
Ligand information
>6gc8 Chain B (length=119) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggca
<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<........<<<<<<<...>>>>>>>....
....>>...>>>>>>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB6gc8 Structural Visualization of the Formation and Activation of the 50S Ribosomal Subunit during In Vitro Reconstitution.
Resolution3.8 Å
Binding residue
(original residue number in PDB)
K68 G69 P70 N72
Binding residue
(residue number reindexed from 1)
K63 G64 P65 N67
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function

View graph for
Biological Process

View graph for
Cellular Component
External links
PDB RCSB:6gc8, PDBe:6gc8, PDBj:6gc8
PDBsum6gc8
PubMed29883607
UniProtP0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)

[Back to BioLiP]