Structure of PDB 5we4 Chain W Binding Site BS02

Receptor Information
>5we4 Chain W (length=75) Species: 562 (Escherichia coli) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
TRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTL
FAKADGKVKFEVKGPKNRKFISIEA
Ligand information
>5we4 Chain B (length=120) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcaa
<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB5we4 Cryo-EM shows stages of initial codon selection on the ribosome by aa-tRNA in ternary complex with GTP and the GTPase-deficient EF-TuH84A.
Resolution3.1 Å
Binding residue
(original residue number in PDB)		G69 P70
Binding residue
(residue number reindexed from 1)		G64 P65
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:5we4, PDBe:5we4, PDBj:5we4
PDBsum5we4
PubMed29733411
UniProtP0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)

[Back to BioLiP]