Structure of PDB 5kpw Chain V Binding Site BS02

Receptor Information

>5kpw Chain V (length=75) Species: 83333 (Escherichia coli K-12)

RNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTLF
AKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>5kpw Chain 28 (length=120)

ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggcaa

<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>.

Receptor-Ligand Complex Structure

Structure summary

• PDB: 5kpw Ribosome•RelA structures reveal the mechanism of stringent response activation.
• Resolution: 3.9 Å
• Binding residue (original residue number in PDB): G69 P70 N72
• Binding residue (residue number reindexed from 1): G63 P64 N66

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:5kpw, PDBe:5kpw, PDBj:5kpw
• PDBsum: 5kpw
• PubMed: 27434674
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)