Structure of PDB 6t4q Chain Sa Binding Site BS02

Receptor Information
>6t4q Chain Sa (length=97) Species: 4932 (Saccharomyces cerevisiae) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
PKKRASNGRNKKGRGHVKPVRCVNCSKSIPKDKAIKRMAIRNIVEAAAVR
DLSEASVYPEYALPKTYNKLHYCVSCAIHARIVRVRSREDRKNRAPP
Ligand information
>6t4q Chain 5 (length=30) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
aauccuggauggaacgaccgcgaccguaaa
..................<<....>>....
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB6t4q Molecular mechanism of translational stalling by inhibitory codon combinations and poly(A) tracts.
Resolution2.6 Å
Binding residue
(original residue number in PDB)
N43 V50 H80
Binding residue
(residue number reindexed from 1)
N42 V49 H79
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function

View graph for
Biological Process

View graph for
Cellular Component
External links
PDB RCSB:6t4q, PDBe:6t4q, PDBj:6t4q
PDBsum6t4q
PubMed31858614
UniProtP39939|RS26B_YEAST Small ribosomal subunit protein eS26B (Gene Name=RPS26B)

[Back to BioLiP]