Structure of PDB 8wic Chain R Binding Site BS02

Receptor Information
>8wic Chain R (length=125) Species: 246196 (Mycolicibacterium smegmatis MC2 155) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
HKPVGQNISEVRRNARLRRHARLRKKVAGTAEVPRLVVNRSARHIHVQLV
NDLNGTTLAAASSIEADVRAIDGDKKAHSVRVGQLIAERAKAAGVETVVF
DRGGYTYGGRIAALADAAREAGLKF
Ligand information
>8wic Chain B (length=117) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
guuacggcgguccauagcggcagggaaacgcccggucccaucccgaaccc
ggaagcuaagccugccagcgccgaugauacuacccauccggguggaaaag
uaggacaccgccgaaca
<<<.<<<<<<<.....<<<<<<<<.....<<<<<...............>
>>..>>....>>>>>>.>>.<<.......<<<<<<....>>>>>>.....
..>>..>>>>>>>>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB8wic Cryo- EM structure of the mycobacterial 70S ribosome in complex with ribosome hibernation promotion factor RafH.
Resolution3.5 Å
Binding residue
(original residue number in PDB)		N9 S11 E12 R14 R15 R18 H22 R26 R37 N41 R42 S43 R45 H46 T59 I66 R71 D76 K77 K78 T108 G111 R112
Binding residue
(residue number reindexed from 1)		N7 S9 E10 R12 R13 R16 H20 R24 R35 N39 R40 S41 R43 H44 T57 I64 R69 D74 K75 K76 T106 G109 R110
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
GO:0008097 5S rRNA binding
GO:0019843 rRNA binding
Biological Process
GO:0006412 translation
Cellular Component
GO:0005737 cytoplasm
GO:0005840 ribosome
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:8wic, PDBe:8wic, PDBj:8wic
PDBsum8wic
PubMed38245551
UniProtA0QSG5

[Back to BioLiP]