Structure of PDB 7s0s Chain Q Binding Site BS02

Receptor Information
>7s0s Chain Q (length=126) Species: 1772 (Mycolicibacterium smegmatis) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
AHKPVGQNISEVRRNARLRRHARLRKKVAGTAEVPRLVVNRSARHIHVQL
VNDLNGTTLAAASSIEADVRAIDGDKKAHSVRVGQLIAERAKAAGVETVV
FDRGGYTYGGRIAALADAAREAGLKF
Ligand information
>7s0s Chain i (length=118) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
guuacggcgguccauagcggcagggaaacgcccggucccaucccgaaccc
ggaagcuaagccugccagcgccgaugauacuacccauccggguggaaaag
uaggacaccgccgaacac
<<<.<<<<<<<.....<<<<<<<<.....<<<<<...............>
>>..>>....>>>>>>.>>.<<.......<<<<<<....>>>>>>.....
..>>..>>>>>>>>>>..
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7s0s 50S subunit recognition and modification by the Mycobacterium tuberculosis ribosomal RNA methyltransferase TlyA.
Resolution3.05 Å
Binding residue
(original residue number in PDB)		N9 S11 E12 R14 R15 H22 R26 R37 N41 S43 H46 H48 Q50 T58 I66 R71 D76 K77 K78 T108 G111 R112
Binding residue
(residue number reindexed from 1)		N8 S10 E11 R13 R14 H21 R25 R36 N40 S42 H45 H47 Q49 T57 I65 R70 D75 K76 K77 T107 G110 R111
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
GO:0008097 5S rRNA binding
GO:0019843 rRNA binding
Biological Process
GO:0006412 translation
Cellular Component
GO:0005737 cytoplasm
GO:0005840 ribosome
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7s0s, PDBe:7s0s, PDBj:7s0s
PDBsum7s0s
PubMed35357969
UniProtA0QSG5

[Back to BioLiP]