Structure of PDB 6wru Chain M Binding Site BS02

Receptor Information
>6wru Chain M (length=56) Species: 1280 (Staphylococcus aureus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
AKLQITLTRSVIGRPETQRKTVEALGLKKTNSSVVVEDNPAIRGQINKVK
HLVTVE
Ligand information
>6wru Chain 2 (length=112) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
cuggugacuauagcaaggaggucacaccuguucccaugccgaacacagaa
guuaagcuccuuagcgacgaugguaguccaacuuacguuccgcuagagua
gaacguuccagg
.<<<........<<<<<<<<.....<<<<<...............>>>..
>>....>>>>>>.>>..........<..............>.........
......>>.>..
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB6wru Characterization of the Core Ribosomal Binding Region for the Oxazolidone Family of Antibiotics Using Cryo-EM.
Resolution3.1 Å
Binding residue
(original residue number in PDB)		R15 H52
Binding residue
(residue number reindexed from 1)		R14 H51
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome
GO:0015934 large ribosomal subunit
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:6wru, PDBe:6wru, PDBj:6wru
PDBsum6wru
PubMed32566908
UniProtP0A0G2|RL30_STAA8 Large ribosomal subunit protein uL30 (Gene Name=rpmD)

[Back to BioLiP]