Structure of PDB 5t5k Chain E Binding Site BS02

Receptor Information
>5t5k Chain E (length=67) Species: 2180 (Methanothermus fervidus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
MELPIAPIGRIIKDAGAERVSDDARITLAKILEEMGRDIASEAIKLARHA
GRKTIKAEDIELAVRRF
Ligand information
>5t5k Chain J (length=90) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
tatgagatctagctcgcacagttgagcgatcaaaaacgccgtagaacgct
ttaattgataatcaaaggccgcagacgacagtacggttca
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB5t5k Structure of histone-based chromatin in Archaea.
Resolution4.0 Å
Binding residue
(original residue number in PDB)		R19 V20 S21 R52 K53 T54 K56
Binding residue
(residue number reindexed from 1)		R19 V20 S21 R52 K53 T54 K56
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003677 DNA binding
GO:0003690 double-stranded DNA binding
GO:0042803 protein homodimerization activity
GO:0046982 protein heterodimerization activity
Biological Process
GO:0006265 DNA topological change
GO:0051260 protein homooligomerization
Cellular Component
GO:0005694 chromosome
GO:0005737 cytoplasm

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:5t5k, PDBe:5t5k, PDBj:5t5k
PDBsum5t5k
PubMed28798133
UniProtP19267|HMFB_METFE DNA-binding protein HMf-2 (Gene Name=hmfB)

[Back to BioLiP]