Structure of PDB 4v7u Chain DW Binding Site BS02

Receptor Information

>4v7u Chain DW (length=79) Species: 83333 (Escherichia coli K-12)

GGSTRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRD
HTLFAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>4v7u Chain DB (length=117)

gccuggcggccguagcgcgguggucccaccugaccccaugccgaacucag
aagugaaacgccguagcgccgaugguaguguggggucuccccaugcgaga
guagggaacugccaggc

<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>>
..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>....
...>>...>>>>>>>>>

Receptor-Ligand Complex Structure

Structure summary

• PDB: 4v7u Structures of the Escherichia coli ribosome with antibiotics bound near the peptidyl transferase center explain spectra of drug action.
• Resolution: 3.1 Å
• Binding residue (original residue number in PDB): K71 P73 K74
• Binding residue (residue number reindexed from 1): K66 P68 K69

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:4v7u, PDBe:4v7u, PDBj:4v7u
• PDBsum: 4v7u
• PubMed: 20876128
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)