Structure of PDB 4u1u Chain DW Binding Site BS02

Receptor Information
>4u1u Chain DW (length=75) Species: 83333 (Escherichia coli K-12) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
RNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTLF
AKADGKVKFEVKGPKNRKFISIEAE
Ligand information
>4u1u Chain DB (length=118) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gccuggcggccguagcgcgguggucccaccugaccccaugccgaacucag
aagugaaacgccguagcgccgaugguaguguggggucuccccaugcgaga
guagggaacugccaggca
<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>>
..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>....
...>>...>>>>>>>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB4u1u Synergy of streptogramin antibiotics occurs independently of their effects on translation.
Resolution2.95 Å
Binding residue
(original residue number in PDB)		P74 N76
Binding residue
(residue number reindexed from 1)		P64 N66
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:4u1u, PDBe:4u1u, PDBj:4u1u
PDBsum4u1u
PubMed24957822
UniProtP0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)

[Back to BioLiP]