Structure of PDB 5t5k Chain C Binding Site BS02

Receptor Information
>5t5k Chain C (length=68) Species: 2180 (Methanothermus fervidus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
MELPIAPIGRIIKDAGAERVSDDARITLAKILEEMGRDIASEAIKLARHA
GRKTIKAEDIELAVRRFK
Ligand information
>5t5k Chain J (length=90) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
tatgagatctagctcgcacagttgagcgatcaaaaacgccgtagaacgct
ttaattgataatcaaaggccgcagacgacagtacggttca
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB5t5k Structure of histone-based chromatin in Archaea.
Resolution4.0 Å
Binding residue
(original residue number in PDB)		I5 A6 P7
Binding residue
(residue number reindexed from 1)		I5 A6 P7
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003677 DNA binding
GO:0003690 double-stranded DNA binding
GO:0042803 protein homodimerization activity
GO:0046982 protein heterodimerization activity
Biological Process
GO:0006265 DNA topological change
GO:0051260 protein homooligomerization
Cellular Component
GO:0005694 chromosome
GO:0005737 cytoplasm

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:5t5k, PDBe:5t5k, PDBj:5t5k
PDBsum5t5k
PubMed28798133
UniProtP19267|HMFB_METFE DNA-binding protein HMf-2 (Gene Name=hmfB)

[Back to BioLiP]