Structure of PDB 4v6t Chain BW Binding Site BS02

Receptor Information
>4v6t Chain BW (length=76) Species: 562 (Escherichia coli) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
TRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTL
FAKADGKVKFEVKGPKNRKFISIEAE
Ligand information
>4v6t Chain BB (length=119) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggca
<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB4v6t The complex of tmRNA-SmpB and EF-G on translocating ribosomes.
Resolution8.3 Å
Binding residue
(original residue number in PDB)		K68 P70 N72
Binding residue
(residue number reindexed from 1)		K63 P65 N67
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:4v6t, PDBe:4v6t, PDBj:4v6t
PDBsum4v6t
PubMed22622583
UniProtP0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)

[Back to BioLiP]