Structure of PDB 6r6g Chain AE Binding Site BS02

Receptor Information
>6r6g Chain AE (length=76) Species: 9615 (Canis lupus familiaris) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
VLLESEQFLTELTRLFQKCRTSGSVYITLKKYDGNKCLLRATDGKKKIST
VVSSKEVNKFQMAYSNLLRANMDGLK
Ligand information
>6r6g Chain AF (length=206) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gccgggcgcgguggcgcgcgccuguagucccagcuacucgggaggcugag
gcuggaggaucgcuugacuaaguucggcaucaauauggugaccucccggg
agcgggggaccaccagguugccuaaggaggggugaaccggcccaggucgg
aaacggagcaggucaaaacucccgugcugaucaguaguuuagcgagaccc
cgucuc
<<<<<<<<<<..(((.>>>>>>>....<<<<.)))....>>>>>>>.<<<
<<.<<....<<<<<.<<<<.<..<<<<<<<<<<<.<<<<<..<<<<<<..
..>>>>>>..>>>>>.>>>>........<<<<<.....<<<<....<<<.
...>>>....>>>>...>>>>>.>>>>>>>....>>>>>.>>>>>...>>
.>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB6r6g Structural and mutational analysis of the ribosome-arresting human XBP1u.
Resolution3.7 Å
Binding residue
(original residue number in PDB)		V2 S25 Y27 K31 Y33 G35 L57 R59 K64
Binding residue
(residue number reindexed from 1)		V1 S24 Y26 K30 Y32 G34 L38 R40 K45
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0008312 7S RNA binding
GO:0030942 endoplasmic reticulum signal peptide binding
Biological Process
GO:0006614 SRP-dependent cotranslational protein targeting to membrane
Cellular Component
GO:0005786 signal recognition particle, endoplasmic reticulum targeting
GO:0048500 signal recognition particle

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:6r6g, PDBe:6r6g, PDBj:6r6g
PDBsum6r6g
PubMed31246176
UniProtP16255|SRP14_CANLF Signal recognition particle 14 kDa protein (Gene Name=SRP14)

[Back to BioLiP]