Structure of PDB 4fth Chain A Binding Site BS02

Receptor Information

>4fth Chain A (length=68) Species: 63363 (Aquifex aeolicus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]

LKEKSWRDLSYLLKIKELKEAKKEFEKIFIEEKLREYDYDLKRTAEEIGI
DLSNLYRKIKSLNIRVKS

Ligand information

>4fth Chain D (length=21) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]

gatgcatttgcaaatttgcaa

Receptor-Ligand Complex Structure

Global view

Local view

Structure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

PDB	4fth DNA Recognition by a sigma (54) Transcriptional Activator from Aquifex aeolicus.
Resolution	3.004 Å
Binding residue (original residue number in PDB)	K29 Y66 R67
Binding residue (residue number reindexed from 1)	K19 Y56 R57
Binding affinity	PDBbind-CN: Kd=200nM

Enzymatic activity

Enzyme Commision number

Gene Ontology

	Molecular Function
GO:0043565	sequence-specific DNA binding

View graph for
Molecular Function

External links

PDB	RCSB:4fth, PDBe:4fth, PDBj:4fth
PDBsum	4fth
PubMed	25158097
UniProt	O66551

[Back to BioLiP]