Structure of PDB 5uyp Chain 25 Binding Site BS02
Receptor Information
| >5uyp Chain 25 (length=75) Species: 83333 (Escherichia coli K-12) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure] |
| RNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTLF AKADGKVKFEVKGPKNRKFISIEAE |
Ligand information
| >5uyp Chain 02 (length=120) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure] |
| ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag aguagggaacugccaggcaa |
| <<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>> >..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>... ....>>...>>>>>>>>>>. |
Receptor-Ligand Complex Structure
| Global view | Local view | Structure summary | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
|
[Spin on] [Spin off] [Reset] [High quality] [Low quality] [White background] [Black background] |
[Spin on] [Spin off] [Reset] [High quality] [Low quality] [White background] [Black background] |
|
Enzymatic activity
| Enzyme Commision number | ? |
Gene Ontology
| Molecular Function | |
|---|---|
| GO:0003735 | structural constituent of ribosome |
