Structure of PDB 7z20 Chain y Binding Site BS01

Receptor Information

>7z20 Chain y (length=82) Species: 562 (Escherichia coli)

HKKAGGSTRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVG
CGRDHTLFAKADGKVKFEVKGPKNRKFISIEA

Ligand information

>7z20 Chain a (length=118)

gccuggcggccguagcgcgguggucccaccugaccccaugccgaacucag
aagugaaacgccguagcgccgaugguaguguggggucuccccaugcgaga
guagggaacugccaggca

<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>>
..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>....
...>>...>>>>>>>>>.

Receptor-Ligand Complex Structure

Structure summary

• PDB: 7z20 Modulating co-translational protein folding by rational design and ribosome engineering.
• Resolution: 2.29 Å
• Binding residue (original residue number in PDB): G73 P74
• Binding residue (residue number reindexed from 1): G71 P72

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:7z20, PDBe:7z20, PDBj:7z20
• PDBsum: 7z20
• PubMed: 35869078
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)