Structure of PDB 6qdw Chain y Binding Site BS01

Receptor Information

>6qdw Chain y (length=74) Species: 469008 (Escherichia coli BL21(DE3))

RNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTLF
AKADGKVKFEVKGPKNRKFISIEA

Ligand information

>6qdw Chain a (length=118)

gccuggcggccguagcgcgguggucccaccugaccccaugccgaacucag
aagugaaacgccguagcgccgaugguaguguggggucuccccaugcgaga
guagggaacugccaggca

<<..<..<<.....<<<<<<<<....<<<<<<<.............>>>>
..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>....
...>>...>>.>...>>.

Receptor-Ligand Complex Structure

Structure summary

• PDB: 6qdw Cysteine oxidation and disulfide formation in the ribosomal exit tunnel.
• Resolution: 2.83 Å
• Binding residue (original residue number in PDB): G73 P74 N76
• Binding residue (residue number reindexed from 1): G63 P64 N66

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:6qdw, PDBe:6qdw, PDBj:6qdw
• PDBsum: 6qdw
• PubMed: 33149120
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)