Structure of PDB 3jbu Chain y Binding Site BS01

Receptor Information

>3jbu Chain y (length=75) Species: 83333 (Escherichia coli K-12)

RNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTLF
AKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>3jbu Chain a (length=118)

gccuggcggccguagcgcgguggucccaccugaccccaugccgaacucag
aagugaaacgccguagcgccgaugguaguguggggucuccccaugcgaga
guagggaacugccaggca

<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>>
..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>....
...>>...>>>>>>>>>.

Receptor-Ligand Complex Structure

Structure summary

• PDB: 3jbu Mechanisms of ribosome stalling by SecM at multiple elongation steps
• Resolution: 3.64 Å
• Binding residue (original residue number in PDB): G73 P74
• Binding residue (residue number reindexed from 1): G63 P64

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:3jbu, PDBe:3jbu, PDBj:3jbu
• PDBsum: 3jbu
• PubMed: 26670735
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)