Structure of PDB 9fbv Chain v Binding Site BS01

Receptor Information

>9fbv Chain v (length=83) Species: 679895 (Escherichia coli BW25113)

HKKAGGSTRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVG
CGRDHTLFAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>9fbv Chain b (length=119)

ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggca

<<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>>

Receptor-Ligand Complex Structure

Structure summary

• PDB: 9fbv Paenilamicins from the honey bee pathogen Paenibacillus larvae are context-specific translocation inhibitors of protein synthesis.
• Resolution: 2.4 Å
• Binding residue (original residue number in PDB): K72 G73 P74 N76
• Binding residue (residue number reindexed from 1): K70 G71 P72 N74

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:9fbv, PDBe:9fbv, PDBj:9fbv
• PDBsum: 9fbv
• PubMed: 38826346
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)