Structure of PDB 8h0w Chain u Binding Site BS01

Receptor Information
>8h0w Chain u (length=73) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
PPVSELITKAVAASKERSGVSLAALKKALAAAGYDVEKNNSRIKLGLKSL
VSKGTLVQTKGTGASGSFKLNKK
Ligand information
>8h0w Chain N (length=196) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ttaaagcaataggtccacttgtgtttggtgtgtttgggaatccggtgccg
aggccgctcaattggtcgtagacagctctagcaccgcttaaacgcacgta
cgcgctgtcccccgcgttttaaccgccaaggggattactccctagtctcc
aggcacgtgtcagatatatacatccaggccttgtgtcgcgaaattc
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB8h0w Structural basis of RNA polymerase II transcription on the chromatosome containing linker histone H1.
Resolution4.6 Å
Binding residue
(original residue number in PDB)		V40 S58 R79 K97 S104
Binding residue
(residue number reindexed from 1)		V3 S21 R42 K60 S67
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003677 DNA binding
GO:0003690 double-stranded DNA binding
GO:0003723 RNA binding
GO:0005515 protein binding
GO:0030527 structural constituent of chromatin
GO:0031490 chromatin DNA binding
GO:0031492 nucleosomal DNA binding
Biological Process
GO:0000122 negative regulation of transcription by RNA polymerase II
GO:0006325 chromatin organization
GO:0006334 nucleosome assembly
GO:0006357 regulation of transcription by RNA polymerase II
GO:0030261 chromosome condensation
GO:0045910 negative regulation of DNA recombination
Cellular Component
GO:0000786 nucleosome
GO:0000791 euchromatin
GO:0005634 nucleus
GO:0005694 chromosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:8h0w, PDBe:8h0w, PDBj:8h0w
PDBsum8h0w
PubMed36435862
UniProtP16403|H12_HUMAN Histone H1.2 (Gene Name=H1-2)

[Back to BioLiP]