Structure of PDB 7pf5 Chain u Binding Site BS01

Receptor Information
>7pf5 Chain u (length=75) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
SGPPVSELITKAVAASKERSGVSLAALKKALAAAGYDVEKNNSRIKLGLK
SLVSKGTLVQTKGTGASGSFKLNKK
Ligand information
>7pf5 Chain J (length=167) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
tacttacatgacaggatgtatatatctgacacgtgcctggagactaggga
gtaatccccttggcggttaaaacgcgggggacagcgcgtacgtgcgttta
agcggtgctagagctgtctacgaccaattgagcggcctcggcaccgggat
tctccaggcggccagtg
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7pf5 Histone H1 binding to nucleosome arrays depends on linker DNA length and trajectory.
Resolution3.8 Å
Binding residue
(original residue number in PDB)		S57 K63 R78 K96 S103
Binding residue
(residue number reindexed from 1)		S23 K29 R44 K62 S69
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003677 DNA binding
GO:0003690 double-stranded DNA binding
GO:0003723 RNA binding
GO:0005515 protein binding
GO:0030527 structural constituent of chromatin
GO:0031490 chromatin DNA binding
GO:0031492 nucleosomal DNA binding
GO:0042826 histone deacetylase binding
Biological Process
GO:0000122 negative regulation of transcription by RNA polymerase II
GO:0006325 chromatin organization
GO:0006334 nucleosome assembly
GO:0006357 regulation of transcription by RNA polymerase II
GO:0030261 chromosome condensation
GO:0045910 negative regulation of DNA recombination
Cellular Component
GO:0000786 nucleosome
GO:0000791 euchromatin
GO:0000792 heterochromatin
GO:0005634 nucleus
GO:0005694 chromosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7pf5, PDBe:7pf5, PDBj:7pf5
PDBsum7pf5
PubMed35581345
UniProtP10412|H14_HUMAN Histone H1.4 (Gene Name=H1-4)

[Back to BioLiP]