Structure of PDB 7obr Chain t Binding Site BS01

Receptor Information
>7obr Chain t (length=76) Species: 9615 (Canis lupus familiaris) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
VLLESEQFLTELTRLFQKCRLSGSVFITLKKYDGNKCLLRATDGKKKIST
VVSSKEVNKFQMAYSNLLRANMDGLK
Ligand information
>7obr Chain 1 (length=249) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gccgggcgcgguggcgcgcgccuguagucccagcuacucgggaggcugag
gcaggaggaucgcuucgcuaugccgaucggguguccgcacuaaguucggc
aucaauauggugaccucccgggagcgggggaccaccagguugccuaagga
ggggugaaccggcccaggucggaaacggagcaggucaaaacucccgugcu
gaucaguagugggaucgcgccugugaauagccuagcgagaccccgucuc
<<<<<<<<<<..(((.>>>>>>>....<<<<.)))....>>>>>>>.<<<
<<.<<.<..<<<<<..<<<<.......<.<.<<<<<.<<<<<.<.<<<<<
<<<<<<.<<<<<..<<<<<<....>>>>>>..>>>>>.>>>>........
<<<<<.....<<<.<.<.<<<....>>>..>.>>>>...>>>>>.>>>>>
>>.>..>>>>>>>...>>>..>>....>>>>..>>>>>..>>>.>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7obr Molecular mechanism of cargo recognition and handover by the mammalian signal recognition particle.
Resolution2.8 Å
Binding residue
(original residue number in PDB)		V2 S23 G24 S25 F27 K31
Binding residue
(residue number reindexed from 1)		V1 S22 G23 S24 F26 K30
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003723 RNA binding
GO:0008312 7S RNA binding
GO:0030942 endoplasmic reticulum signal peptide binding
Biological Process
GO:0006614 SRP-dependent cotranslational protein targeting to membrane
GO:0045047 protein targeting to ER
Cellular Component
GO:0005737 cytoplasm
GO:0005786 signal recognition particle, endoplasmic reticulum targeting
GO:0005829 cytosol
GO:0048500 signal recognition particle

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7obr, PDBe:7obr, PDBj:7obr
PDBsum7obr
PubMed34260909
UniProtP16255|SRP14_CANLF Signal recognition particle 14 kDa protein (Gene Name=SRP14)

[Back to BioLiP]