Structure of PDB 7pkt Chain Y Binding Site BS01

Receptor Information
>7pkt Chain Y (length=149) Species: 3055 (Chlamydomonas reinhardtii) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Ligand information
>7pkt Chain 0 (length=75) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
ggugcucggugaaaccgagcauccaauacuaaagaaacuuuacuggcuua
guacugggaccccauuuuuaguaua
<<<<<<<<<<...>>>>>>>>>>..<<<<<<<<<<.......<<<<....
...>>>>.......>>>>>>>>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7pkt How to build a ribosome from RNA fragments in Chlamydomonas mitochondria.
Resolution3.0 Å
Binding residue
(original residue number in PDB)
X11 X12 X26 X29 X30 X33 X37 X70
Binding residue
(residue number reindexed from 1)
X11 X12 X23 X26 X27 X30 X34 X55
External links