Structure of PDB 8qpp Chain W Binding Site BS01

Receptor Information
>8qpp Chain W (length=86) Species: 1423 (Bacillus subtilis) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
KGKDYHVSLELDLRGERYENALSRVEKYLDDAVLAGYPRVSIIHGKGTGA
LRKGVQDLLKNHRSVKSSRFGEAGEGGSGVTVVELK
Ligand information
>8qpp Chain V (length=33) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
agaccaaugccauguacgucgcacucggaagac
.................................
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB8qpp An evolutionarily conserved strategy for ribosome binding and inhibition by beta-coronavirus non-structural protein 1
Resolution3.4 Å
Binding residue
(original residue number in PDB)		L712 Y717 I741 H743 G744 K745 G746 T747 G748 A749 L750 R751 G775 T780
Binding residue
(residue number reindexed from 1)		L13 Y18 I42 H44 G45 K46 G47 T48 G49 A50 L51 R52 G76 T81
Gene Ontology
--> -->
 
 
UnboundLocalError		Python 3.6.8: /usr/bin/python3
Sat Nov 16 19:43:25 2024

A problem occurred in a Python script. Here is the sequence of function calls leading up to the error, in the order they occurred.

 /var/www/html/BioLiP/pdb.cgi in <module>()
   1435     title=pdb2title(pdbid)
   1436     if bs.startswith("BS"):
=> 1437         pubmed,uniprot=display_interaction(pdbid,asym_id,bs,title)
   1438     else:
   1439         if lig3:
pubmed = '', uniprot = '', display_interaction = <function display_interaction>, pdbid = '8qpp', asym_id = 'W', bs = 'BS01', title = 'An evolutionarily conserved strategy for ribosom...tion by beta-coronavirus non-structural protein 1'
 /var/www/html/BioLiP/pdb.cgi in display_interaction(pdbid='8qpp', asym_id='W', bs='BS01', title='An evolutionarily conserved strategy for ribosom...tion by beta-coronavirus non-structural protein 1')
   1295         display_ec(ec,csaOrig,csaRenu)
   1296     if go:
=> 1297         display_go(go,uniprot,pdbid,asym_id)
   1298     return pubmed,uniprot
   1299 
global display_go = <function display_go>, go = '0004519,0005524,0006298,0016887,0030983,0045910', uniprot = '', pdbid = '8qpp', asym_id = 'W'
 /var/www/html/BioLiP/pdb.cgi in display_go(go='0004519,0005524,0006298,0016887,0030983,0045910', uniprot='', pdbid='8qpp', asym_id='W')
    480         '''.replace("$namespace_link",namespace_link
    481           ).replace("$namespace",namespace
=>  482           ).replace("$uniprot",u
    483         ))
    484         for l,(term,name) in enumerate(go2aspect[Aspect]):
u undefined

UnboundLocalError: local variable 'u' referenced before assignment
      args = ("local variable 'u' referenced before assignment",)
      with_traceback = <built-in method with_traceback of UnboundLocalError object>