Structure of PDB 8g31 Chain W Binding Site BS01

Receptor Information

>8g31 Chain W (length=79) Species: 562 (Escherichia coli)

GGSTRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRD
HTLFAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>8g31 Chain A (length=117)

gccuggcggccguagcgcgguggucccaccugaccccaugccgaacucag
aagugaaacgccguagcgccgaugguaguguggggucuccccaugcgaga
guagggaacugccaggc

<<<<<<<<<.....<<<<<<<<....<<<<<<<.............>>>>
..>>>...>>>>>>.>>.<<...<...<<<<<<<<...>>>>>>>>....
.>.>>...>>>>>>>>>

Receptor-Ligand Complex Structure

Structure summary

• PDB: 8g31 Time-resolved cryo-EM study of the 70S recycling by the HflX:control-apo-70S at 900ms
• Resolution: 3.2 Å
• Binding residue (original residue number in PDB): V70 K71 G72 P73 N75
• Binding residue (residue number reindexed from 1): V65 K66 G67 P68 N70

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:8g31, PDBe:8g31, PDBj:8g31
• PDBsum: 8g31
• PubMed: 38244547
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)