Structure of PDB 7bl5 Chain W Binding Site BS01

Receptor Information

>7bl5 Chain W (length=76) Species: 511145 (Escherichia coli str. K-12 substr. MG1655)

TRNGRDSEAKRLGVKRFGGESVLAGSIIVRQRGTKFHAGANVGCGRDHTL
FAKADGKVKFEVKGPKNRKFISIEAE

Ligand information

>7bl5 Chain B (length=119)

ugccuggcggccguagcgcgguggucccaccugaccccaugccgaacuca
gaagugaaacgccguagcgccgaugguaguguggggucuccccaugcgag
aguagggaacugccaggca

.<<<<<<<<<.....<<<<<<<<....<<<<<<...............>>
>..>>>...>>>>>>.>>.<<.......<<<<<<<<...>>>>>>>>...
....>>...>>>>>>>>>.

Receptor-Ligand Complex Structure

Structure summary

• PDB: 7bl5 Snapshots of native pre-50S ribosomes reveal a biogenesis factor network and evolutionary specialization.
• Resolution: 3.3 Å
• Binding residue (original residue number in PDB): V67 K68 P70 N72
• Binding residue (residue number reindexed from 1): V62 K63 P65 N67

Gene Ontology

Molecular Function

• GO:0000049 tRNA binding
• GO:0003735 structural constituent of ribosome
• GO:0005515 protein binding
• GO:0019843 rRNA binding
• GO:0043022 ribosome binding

Biological Process

• GO:0000027 ribosomal large subunit assembly
• GO:0001558 regulation of cell growth
• GO:0002181 cytoplasmic translation
• GO:0006412 translation
• GO:0042256 cytosolic ribosome assembly
• GO:0090070 positive regulation of ribosome biogenesis
• GO:1902626 assembly of large subunit precursor of preribosome

Cellular Component

• GO:0005737 cytoplasm
• GO:0005840 ribosome
• GO:0022625 cytosolic large ribosomal subunit
• GO:1990904 ribonucleoprotein complex

External links

• PDB: RCSB:7bl5, PDBe:7bl5, PDBj:7bl5
• PDBsum: 7bl5
• PubMed: 33639093
• UniProt: P0A7L8|RL27_ECOLI Large ribosomal subunit protein bL27 (Gene Name=rpmA)