Structure of PDB 7pfc Chain U Binding Site BS01

Receptor Information
>7pfc Chain U (length=75) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
SGPPVSELITKAVAASKERSGVSLAALKKALAAAGYDVEKNNSRIKLGLK
SLVSKGTLVQTKGTGASGSFKLNKK
Ligand information
>7pfc Chain J (length=344) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
tacttacatgacaggatgtatatatctgacacgtgcctggagactaggga
gtaatccccttggcggttaaaacgcgggggacagcgcgtacgtgcgttta
agcggtgctagagctgtctacgaccaattgagcggcctcggcaccgggat
tctccagtatggcggccagtgccttaatacttacatgacaggatgtatat
atctgacacgtgcctggagactagggagtaatccccttggcggttaaaac
gcgggggacagcgcgtacgtgcgtttaagcggtgctagagctgtctacga
ccaattgagcggcctcggcaccgggattctccagtatggcggcc
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB7pfc Histone H1 binding to nucleosome arrays depends on linker DNA length and trajectory.
Resolution6.4 Å
Binding residue
(original residue number in PDB)		V39 R53 G55 S57 R78 K96 G97 S101 G102 S103
Binding residue
(residue number reindexed from 1)		V5 R19 G21 S23 R44 K62 G63 S67 G68 S69
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003677 DNA binding
GO:0003690 double-stranded DNA binding
GO:0003723 RNA binding
GO:0005515 protein binding
GO:0030527 structural constituent of chromatin
GO:0031490 chromatin DNA binding
GO:0031492 nucleosomal DNA binding
GO:0042826 histone deacetylase binding
Biological Process
GO:0000122 negative regulation of transcription by RNA polymerase II
GO:0006325 chromatin organization
GO:0006334 nucleosome assembly
GO:0006357 regulation of transcription by RNA polymerase II
GO:0030261 chromosome condensation
GO:0045910 negative regulation of DNA recombination
Cellular Component
GO:0000786 nucleosome
GO:0000791 euchromatin
GO:0000792 heterochromatin
GO:0005634 nucleus
GO:0005694 chromosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:7pfc, PDBe:7pfc, PDBj:7pfc
PDBsum7pfc
PubMed35581345
UniProtP10412|H14_HUMAN Histone H1.4 (Gene Name=H1-4)

[Back to BioLiP]