Structure of PDB 3jaj Chain S4 Binding Site BS01

Receptor Information
>3jaj Chain S4 (length=76) Species: 9986 (Oryctolagus cuniculus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
VLLESEQFLTELTRLFQKCRTSGSVYITLKKYDGNKCLLRATDGKKKIST
VVSSKEVNKFQMAYSNLLRANMDGLK
Ligand information
>3jaj Chain 4 (length=206) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gccgggcgcgguggcgcgcgccuguagucccagcuacucgggaggcugag
gcuggaggaucgcuuuagcgagaccccgucucgacuaaguucggcaucaa
uauggugaccucccgggagcgggggaccaccagguugccuaaggaggggu
gaaccggcccaggucggaaacggagcaggucaaaacucccgugcugauca
guaguu
<<<<<<<<<<..(((.>>>>>>>....<<<<.)))....>>>>>>>..<<
<<.<<....<<<<<..>>>>>...>>.>>>>.<<<<.<..<<<<<<<<<<
<.<<<<<..<<<<<<....>>>>>>..>>>>>.>>>>........<<<<<
.....<<<<....<<<....>>>....>>>>...>>>>>.>>>>>>>...
.>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB3jaj Structures of the scanning and engaged states of the mammalian SRP-ribosome complex.
Resolution3.75 Å
Binding residue
(original residue number in PDB)		V2 G24 S25 Y27 K31 Y33 G35 L57 R59 K64
Binding residue
(residue number reindexed from 1)		V1 G23 S24 Y26 K30 Y32 G34 L38 R40 K45
Gene Ontology
--> -->
 
 
UnboundLocalError		Python 3.6.8: /usr/bin/python3
Fri Nov 15 11:39:10 2024

A problem occurred in a Python script. Here is the sequence of function calls leading up to the error, in the order they occurred.

 /var/www/html/BioLiP/pdb.cgi in <module>()
   1435     title=pdb2title(pdbid)
   1436     if bs.startswith("BS"):
=> 1437         pubmed,uniprot=display_interaction(pdbid,asym_id,bs,title)
   1438     else:
   1439         if lig3:
pubmed = '', uniprot = '', display_interaction = <function display_interaction>, pdbid = '3jaj', asym_id = 'S4', bs = 'BS01', title = 'Structures of the scanning and engaged states of the mammalian SRP-ribosome complex.'
 /var/www/html/BioLiP/pdb.cgi in display_interaction(pdbid='3jaj', asym_id='S4', bs='BS01', title='Structures of the scanning and engaged states of the mammalian SRP-ribosome complex.')
   1295         display_ec(ec,csaOrig,csaRenu)
   1296     if go:
=> 1297         display_go(go,uniprot,pdbid,asym_id)
   1298     return pubmed,uniprot
   1299 
global display_go = <function display_go>, go = '0005786,0006614,0008312,0030942,0048500', uniprot = '', pdbid = '3jaj', asym_id = 'S4'
 /var/www/html/BioLiP/pdb.cgi in display_go(go='0005786,0006614,0008312,0030942,0048500', uniprot='', pdbid='3jaj', asym_id='S4')
    480         '''.replace("$namespace_link",namespace_link
    481           ).replace("$namespace",namespace
=>  482           ).replace("$uniprot",u
    483         ))
    484         for l,(term,name) in enumerate(go2aspect[Aspect]):
u undefined

UnboundLocalError: local variable 'u' referenced before assignment
      args = ("local variable 'u' referenced before assignment",)
      with_traceback = <built-in method with_traceback of UnboundLocalError object>