Structure of PDB 5eey Chain S Binding Site BS01

Receptor Information
>5eey Chain S (length=70) Species: 1422 (Geobacillus stearothermophilus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
TNSDFVVIKALEDGVNVIGLTRGADTRFHHSEKLDKGEVLIAQFTEHTSA
IKVRGKAYIQTRHGVIESEG
Ligand information
>5eey Chain W (length=44) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gagugagugagugagugagugagugagugagugagugagugagu
............................................
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB5eey RNA protects a nucleoprotein complex against radiation damage.
Resolution1.98 Å
Binding residue
(original residue number in PDB)
G18 F32 H34 S35 E36 K37 D39 R58
Binding residue
(residue number reindexed from 1)
G14 F28 H30 S31 E32 K33 D35 R54
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003723 RNA binding
GO:0005515 protein binding
GO:0042802 identical protein binding
Biological Process
GO:0006353 DNA-templated transcription termination
GO:0006355 regulation of DNA-templated transcription

View graph for
Molecular Function

View graph for
Biological Process
External links
PDB RCSB:5eey, PDBe:5eey, PDBj:5eey
PDBsum5eey
PubMed27139628
UniProtQ9X6J6|MTRB_GEOSE Transcription attenuation protein MtrB (Gene Name=mtrB)

[Back to BioLiP]