Structure of PDB 5zeb Chain P Binding Site BS01

Receptor Information
>5zeb Chain P (length=126) Species: 246196 (Mycolicibacterium smegmatis MC2 155) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
AHKPVGQNISEVRRNARLRRHARLRKKVAGTAEVPRLVVNRSARHIHVQL
VNDLNGTTLAAASSIEADVRAIDGDKKAHSVRVGQLIAERAKAAGVETVV
FDRGGYTYGGRIAALADAAREAGLKF
Ligand information
>5zeb Chain B (length=117) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
guuacggcgguccauagcggcagggaaacgcccggucccaucccgaaccc
ggaagcuaagccugccagcgccgaugauacuacccuuccggguggaaaag
uaggacaccgccgaaca
<<<..<..<..........<........<.<...................
>...>.......>.................<.<......>.>........
.......>..>..>>>.
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB5zeb Structures of Mycobacterium smegmatis 70S ribosomes in complex with HPF, tmRNA, and P-tRNA.
Resolution3.4 Å
Binding residue
(original residue number in PDB)		H3 K4 P5 N9 I10 S11 E12 R14 R15 H22 R26 R37 N41 R42 S43 A44 R45 H46 Q50 V52 T59 I66 D76 K77 K78 T108 G111 R112
Binding residue
(residue number reindexed from 1)		H2 K3 P4 N8 I9 S10 E11 R13 R14 H21 R25 R36 N40 R41 S42 A43 R44 H45 Q49 V51 T58 I65 D75 K76 K77 T107 G110 R111
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
GO:0008097 5S rRNA binding
GO:0019843 rRNA binding
Biological Process
GO:0006412 translation
Cellular Component
GO:0005737 cytoplasm
GO:0005840 ribosome
GO:0022625 cytosolic large ribosomal subunit
GO:1990904 ribonucleoprotein complex

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:5zeb, PDBe:5zeb, PDBj:5zeb
PDBsum5zeb
PubMed30206241
UniProtA0QSG5

[Back to BioLiP]